|
|
|
|
Untitled-5
...
author: Dan Jones
updated: 21/04/2006
matching:
testi express sequenc 12
|
|
|
NF-kB manual 2006.qxp
...
author: Administrator
updated: 17/04/2006
matching:
testi express sequenc 12
|
|
|
Matrix Metalloproteinase 15, Recombinant Hemopex domain (MT2, MMP-15)
-- Search - Molecular Biology Ion Channel Actin Actin Adipocytes Agarose Albumin All Other Amino Acids Angiopoietin Antibiotics Apoptosis Apoptosis A-I Aquaporin Assay Detection Assay Detection Binding Factors Binding Factors Biochemicals Cadherin Calcitonin Carbohydrates, Glycoproteins Cardiac Markers CD Markers CD Markers 101-150 CD Markers 51-75 Cells, Blood Components Centromeres...
duplicates:
http://www.usbio.net/Product.aspx?ProdSku=M2430-05
|
|
|
Ion Channel
-- Search - Molecular Biology Ion Channel Actin Actin Adipocytes Agarose Albumin All Other Amino Acids Angiopoietin Antibiotics Apoptosis Apoptosis A-I Aquaporin Assay Detection Assay Detection Binding Factors Binding Factors Biochemicals Cadherin Calcitonin Carbohydrates, Glycoproteins Cardiac Markers CD Markers CD Markers 101-150 CD Markers 51-75 Cells, Blood Components Centromeres...
duplicates:
http://www.usbio.net/Category.aspx?CatName=MB-Ion+Channel
http://www.usbio.net/Category.aspx?catName=MB-Ion+Channel
|
|
|
Antibodies
Tissue Specificity: Brain > Retina > Testis > Pineal > > > > Kidney > Spleen > Adrenal, Lung, Heart, Liver, Ovary, Thyroid.
Tissue Specificity: Brain > Retina > Testis > Pineal > > > > Kidney > Spleen > Adrenal, Lung, Heart, Liver, Ovary, Thyroid.
|
|
|
Antibodies
-- Search - Antibodies Abs to Cardiac Markers 14-3-3 Actin Adipocytes Albumin All Other A-C All Other D-L All Other M-P All Other Q-Z Amino Acids Amyloid Angiopoietin Antibiotics Apoptosis Apoptosis A-I Apoptosis Caspase Apoptosis J-Z Aquaporin Assay Detection Assay Detection/Tags B Cells B CellsAbs to MHC Bacteriophage Binding Factors Biochemicals Blood Groups Cadherin Calcitonin...
duplicates:
http://www.usbio.net/Category.aspx?catName=Antibodies
|
|
|
Proteins M-Z
MOP3 (Members of PAS Superfamily, BMAL1, Brain And Muscle ARNT-like 1, JAP3, PAS3, CYCLE) More Details Specificity: Drosophila sequence has no significant sequence homology with mammalian Clock or Per proteins Form: Supplied as a liquid in PBS, pH 7.2 ')" onMouseOut="hideTip()" href="Product.aspx?ProdSku=M4590-03">MOP3 (Members of PAS...
|
|
|
Glucose Transporters
Immunogen: A cytoplasmic 12 AA C-terminal peptide sequence specific from the mouse glucose transporter-4 (Glut-4) was selected near the C-terminus (1).
Also shows reactivity to human testis, human intestinal cell homogenates and spermatozo...
Also shows reactivity to human testis, human intestinal cell homogenates and spermatozo...
|
|
|
G Proteins
Also recognizes the smaller Brx splice variant at 160kD in testis.
Also recognizes the smaller Brx splice variant at 160kD in testis.
Immunogen:-- Peptide with sequence NLLNDLQANSLK, from C Terminus of the protein sequence according to NP_002913.
|
|
|
All Other A-C
Specificity: ACT (Activator of CREM in testis), N terminus.
Specificity:-- ACT (Activator of CREM in testis), N terminus.
81% sequence identity to human.
Reactivity with mouse Artemis is unlikely owing to divergence of sequence at the site to which the epitope maps.
|
|
|
Interleukin-1 Family: Ligands & Receptors
8 IL-1F7 IL-1F7 is expressed in most tissues, with relatively high levels in testis, thymus and uterus.
8 It is expressed in tonsil, bone marrow, heart, placenta, lung, testis, colon, monocytes and B cells.
|
|
|
Products
in the testis, (Sertoli and Leydig cells), fibroblasts, breast epithelium, in hepatocytes and the prostate.
Especially prominent in the mesangial cells of renal glomeruli and in the Sertoli cells of testis.
|
|
|
Produkte
in the testis, (Sertoli and Leydig cells), fibroblasts, breast epithelium, in hepatocytes and the prostate.
Especially prominent in the mesangial cells of renal glomeruli and in the Sertoli cells of testis.
|
|
|
Invitrogen - Molecular Probes - List of Figures
Figure 5.3 — T2556; tris-(2-carboxyethyl)phosphine, hydrochloride (TCEP) Figure 5.4 — SPDP derivatization reactions Figure 5.5 — Derivatization reactions with TS-Link TFP-X thiosulfate Figure 5.6 — Two-step reaction sequence for crosslinking biomolecules using SMCC Figure 5.7 — Chemical basis for thiol detection using the Thiol and Sulfide Quantitation...
|
|
|
mmtv - The Jackson Laboratory
Spot Index GenBank ID Gene Description 1708 BG071503 2556 BG075927 2714 BG065308 Homo sapiens KIAA0396 mRNA, partial cds 4230 BG069868 5812 BG076059 5902 BG063471 Mus musculus fibrillarin (Fbl), mRNA 7576 BG085134 M.musculus Cd24a gene 7668 AW550650 Mus musculus t-complex testis expressed 1 (Tctex1), mRNA 8166 BG071318 8604 BG065626 10064 BG070224 11752 BG076877 Mouse...
|
|
|
TJL T31 RH Data Chr X refs
Encodes Gene Tcte1l, t-complex-associated-testis-expressed 1-like, in MGI October 2003.
Genetic analysis of testis weight and fertility in an interspecies hybrid congenic strain for Chromosome X.
Genetic analysis of testis weight and fertility in an interspecies hybrid congenic strain for Chromosome X.
|
|
|
TJL T31 RH Data Chr 18 refs
Stratagene mouse testis (#937308) Mus musculus cDNA clone IMAGE:515968 3'.
AA675331 is MouseBLASTN: 311 / 311 bp match to BC026770, Mus musculus, expressed sequence AA675331, clone MGC:30497 IMAGE:4234600, mRNA, complete cds.
|
|
|
TJL T31 RH Data Chr 17 refs
Whitehead marker name 973797, Whitehead assay name M297-C01, Genbank sequence accession number AW557215, mouse newborn ovary cDNA library clone L0279A11 3', mRNA sequence, matches at 99 % / 558 to Unigene Mm.18643, t-complex testis-expressed 3.
|
|
|
TJL T31 RH Data Chr 16 refs
AA212096 is MouseBLASTN: 457 / 467 bp match to AK006137, Mus musculus adult male testis cDNA, RIKEN full-length enriched library, clone:1700019O22:MDGL-1, full insert sequence.
Forward primer sequence AAGGCTTCAGCACTAAAGGTC, reverse primer sequence TTCCCAGCACAAGAAAGGAG.
|
|
|
TJL T31 RH Data Chr 14 refs
Whitehead marker name 1058113, Whitehead assay name M316-C02, Genbank sequence accession number BB055853, RIKEN full-length enriched, 12 days embryo male wolffian duct Mus musculus cDNA clone 6720484K15 3', mRNA sequence.
#pli2.1, unknown cDNA from testis.
|
|
|
TJL T31 RH Data Chr 12 refs
Also 260/272 bp match to AK006529 Mus musculus adult male testis cDNA, RIKEN full-length enriched library, clone:1700030C10, full insert sequence.
IRS-PCR sequence derived from mouse Chr 12 BAC, based on duplicate assays with Chr 12 inter-B1 repeat sequences hybridized to dot blots of B1-amplified T31 cell line DNAs.
|
|
|
TJL T31 RH Data Chr 10 refs
MouseBLASTN: 406 / 406 bp match to AK019656, Mus musculus adult male testis cDNA, RIKEN full-length enriched library, clone: 4930486E11: ring finger protein 4, full insert sequence.
Matches 126/129 bp to AK006162 Mus musculus adult male testis cDNA, RIKEN full-length enriched library, clone:1700020H09, full insert sequence.
|
|
|
TJL T31 RH Data Chr 9 refs
MouseBLASTN: 356 / 374 bp match to AK014896, Mus musculus adult male testis cDNA, RIKEN full-length enriched library, clone: 4921514K14: testis exprtessed gene 12, full insert sequence.
Tex12, testis exprtessed gene 12, genomic sequence tagged site.
|
|
|
TJL T31 RH Data Chr 8 refs
AV321554 is RIKEN full-length enriched, 13 days embryo male testis clone 6030435I16 3', mRNA sequence.
AV318882 is RIKEN full-length enriched, 13 days embryo male testis clone 6030402C17 3' mRNA sequence.
Tex15, testis expressed gene 15, genomic sequence tagged site.
|
|
|
TJL T31 RH Data Chr 7 refs
Genbank sequence accession number AI429076 is MouseBLASTN: 489 / 494 bp match to AK005769, Mus musculus adult male testis cDNA, RIKEN full-length enriched library, clone:1700008H15: testis expressed gene 101, full insert sequence.
|
